Plant-tc Monthly Archive - February 2001

[Subject Prev][Subject Next][Thread Prev][Thread Next][Subject Index][Thread Index]

npt11 gene primers



Hi everyone,

I have developed some transgenic tomato and potato and would like to test
it by PCR using npt 11 gene primers.
Does anybody know whether it is possible to get the following npt11 gene
primers from any supplier? Your input in helping this matter will be
highly appreciated.


KAN-R:  GAGGCTATTCGGCTATGACTG
 KAN-F:  ATCGGGAGCGGCGATACCGTA


Thank you
Reena Pinhero
University of Guelph
Ontario, Canada >

[Subject Prev][Subject Next][Thread Prev][Thread Next]
Plant-tc Listserv Homepage | Subject Index | Thread Index