Re: npt11 gene primers

Subject: Re: npt11 gene primers
From: Ahmad Parveez <parveez@MPOB.GOV.MY>
Date: Tue, 20 Feb 2001 09:52:33 +0800
Comments: To: Reena Pinhero <rpinhero@uoguelph.ca>
Organization: Malaysian Palm Oil Board (MPOB)
Reply-To: Plant Tissue Culture <PLANT-TC@TC.UMN.EDU>
Sender: Plant Tissue Culture <PLANT-TC@TC.UMN.EDU>

Dear Reena,

You could ask the supplier of your molecular biology items to get the primers
synthesized for you. You might even have the facility to synthesize primers
within your institution/university. The best guest is the ask the
people/store where you always purchase you molecular biology items such as
restriction enzymes or PCR enzymes and etc.

Sorry if the above is not the case in Canada.But I'm sure it works in
Malaysia  and UK.

regards

Parveez
MPOB

Reena Pinhero wrote:

> Hi everyone,
>
> I have developed some transgenic tomato and potato and would like to test
> it by PCR using npt 11 gene primers.
> Does anybody know whether it is possible to get the following npt11 gene
> primers from any supplier? Your input in helping this matter will be
> highly appreciated.
>
> KAN-R:  GAGGCTATTCGGCTATGACTG
>  KAN-F:  ATCGGGAGCGGCGATACCGTA
>
> Thank you
> Reena Pinhero
> University of Guelph
> Ontario, Canada >

[Subject Prev][Subject Next][Thread Prev][Thread Next]

Plant-tc Listserv Homepage | Subject Index | Thread Index